WormMine: Gene WBGene00036917

• WormBase Gene ID: WBGene00036917
• Gene Name: CBG17210
• Sequence Name: CBG17210
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP:ADP antiporter activity. Predicted to be involved in mitochondrial ADP transmembrane transport and mitochondrial ATP transmembrane transport. Predicted to be located in mitochondrial inner membrane. Is an ortholog of C. elegans R07E3.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17210.1	CBG17210.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17210	CBG17210		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1070079
• Remark: CBG17210, TGCTATCCGTTGGATACTGTACGACGCAGTATGATGATGCAAGCTGGAAAGAAAGTGAAG, WBGene00036917
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term