WormMine: Gene WBGene00036965

• WormBase Gene ID: WBGene00036965
• Gene Name: Cbr-abts-2
• Sequence Name: CBG17294
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable solute:inorganic anion antiporter activity. Predicted to be involved in monoatomic anion transport. Predicted to be located in membrane. Is an ortholog of C. elegans abts-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17294.1	CBG17294.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17294	CBG17294		[unknown]

0 RNAi Result

2 Allele

• WBVar00022687
• WBVar00022692

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050950
• Remark: Cbr-abts-2, TCATATGAAGGCCCTTTCAAATGTTGAGGATCGTCTACACAACGGATACATTCAAACGGT, WBGene00036965
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term