WormMine: Gene WBGene00036993

• WormBase Gene ID: WBGene00036993
• Gene Name: Cbr-pek-1
• Sequence Name: CBG17340
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans pek-1. In C. elegans, pek-1 is involved in PERK-mediated unfolded protein response; nematode larval development; and regulation of macromolecule metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17340.1	CBG17340.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17340	CBG17340		[unknown]

0 RNAi Result

18 Allele

• WBVar00023162
• WBVar00023227
• WBVar00023197
• WBVar00023167
• WBVar00023202
• WBVar00023172
• WBVar00023142
• WBVar00023207
• WBVar00023177
• WBVar00023147
• WBVar00023212
• WBVar00023182
• WBVar00023152
• WBVar00023217
• WBVar00023187
• WBVar00023157
• WBVar00023222
• WBVar00023192

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1068661
• Remark: Cbr-pek-1, GCTCACAAGTCTCGATCCATCAAATCGTCCATCAGCATCTGAACTGGCAAACCATCCATT, WBGene00036993
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term