WormMine: Gene WBGene00037100

• WormBase Gene ID: WBGene00037100
• Gene Name: CBG17492
• Sequence Name: CBG17492
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in mRNA processing. Is an ortholog of C. elegans T12A2.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17492.1	CBG17492.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17492	CBG17492		[unknown]

0 RNAi Result

30 Allele

• WBVar00125510
• WBVar00125502
• WBVar00125503
• WBVar00125500
• WBVar00125501
• WBVar00125506
• WBVar00125507
• WBVar00125504
• WBVar00125505
• WBVar00125508
• WBVar00125509
• WBVar00125520
• WBVar00125513
• WBVar00125514
• WBVar00125511
• WBVar00125512
• WBVar00125517
• WBVar00125518
• WBVar00125515
• WBVar00125516
• WBVar00125519
• WBVar00125498
• WBVar00125499
• WBVar00023687
• WBVar00023692
• WBVar00023697
• WBVar00023702
• WBVar00023707
• WBVar00023712
• WBVar00023717

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050370
• Remark: CBG17492, GGATTTCCACGCAAAATACACTACGGTTGATCAGAAGCCAATGGAGTCGATGGATTTGAT, WBGene00037100
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term