WormMine: Gene WBGene00037257

• WormBase Gene ID: WBGene00037257
• Gene Name: Cbr-atic-1
• Sequence Name: CBG17698
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable IMP cyclohydrolase activity and phosphoribosylaminoimidazolecarboxamide formyltransferase activity. Predicted to be involved in purine nucleotide biosynthetic process. Is an ortholog of C. elegans atic-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17698b.1	CBG17698b.1		[unknown]
Transcript:CBG17698a.1	CBG17698a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17698a	CBG17698a		[unknown]
CDS:CBG17698b	CBG17698b		[unknown]

0 RNAi Result

14 Allele

• WBVar00138646
• WBVar00138645
• WBVar00138648
• WBVar00138647
• WBVar00138649
• WBVar00032014
• WBVar00032009
• WBVar00032004
• WBVar00125690
• WBVar00125691
• WBVar00125689
• WBVar00125687
• WBVar00125688
• WBVar00125686

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052672
• Remark: CBG17698, CATCGGAGACTGAGGAACGTACTGTATTTGGGTTGAGACTTCGACAAAAACGAAACAATG, WBGene00037257
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term