WormMine: Gene WBGene00037354

• WormBase Gene ID: WBGene00037354
• Gene Name: Cbr-fce-2.3
• Sequence Name: CBG17836
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metalloendopeptidase activity. Predicted to be involved in CAAX-box protein processing. Predicted to be located in endoplasmic reticulum membrane. Is an ortholog of C. elegans fce-2. In C. elegans, fce-2 is involved in CAAX-box protein processing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17836c.1	CBG17836c.1		[unknown]
Transcript:CBG17836d.1	CBG17836d.1		[unknown]
Transcript:CBG17836a.1	CBG17836a.1		[unknown]
Transcript:CBG17836b.1	CBG17836b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17836d	CBG17836d		[unknown]
CDS:CBG17836c	CBG17836c		[unknown]
CDS:CBG17836b	CBG17836b		[unknown]
CDS:CBG17836a	CBG17836a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053078
• Remark: CBG17836, CAATTGCAGACGAAACACGCGATGGTGCCGATCATTGCTCATACGATCTGTAATGCACAG, WBGene00037354
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term