WormMine: Gene WBGene00037500

• WormBase Gene ID: WBGene00037500
• Gene Name: Cbr-emb-5
• Sequence Name: CBG18001
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in transcription elongation-coupled chromatin remodeling. Is an ortholog of C. elegans emb-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18001.1	CBG18001.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18001	CBG18001		[unknown]

0 RNAi Result

1 Allele

• WBVar00024442

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057531
• Remark: Cbr-emb-5, AAGTGGAGAGGGATACCATTGACAGTATGATACCCGAACATACGGAAGAGGATCAATACA, WBGene00037500
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term