WormMine: Gene WBGene00037587

• WormBase Gene ID: WBGene00037587
• Gene Name: Cbr-trp-1
• Sequence Name: CBG18103
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium channel activity. Predicted to be involved in calcium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans trp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18103a.1	CBG18103a.1		[unknown]
Transcript:CBG18103b.1	CBG18103b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18103a	CBG18103a		[unknown]
CDS:CBG18103b	CBG18103b		[unknown]

0 RNAi Result

2 Allele

• WBVar00126029
• WBVar00025249

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054606
• Remark: Cbr-trp-1, CTGCTGCCAGTTTTCGCTCAACCACCTCATAGTGCACTTCGAAAAACAGATACATCAATG, WBGene00037587
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term