WormMine: Gene WBGene00037794

• WormBase Gene ID: WBGene00037794
• Gene Name: Cbr-rabx-5
• Sequence Name: CBG18351
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and zinc ion binding activity. Is an ortholog of C. elegans rabx-5. In C. elegans, rabx-5 is involved in endosomal vesicle fusion and molting cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18351.1	CBG18351.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18351	CBG18351		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052014
• Remark: Cbr-rabx-5, CTGAACTCAGCATGTAATCAAGCGATGTATGTGCTAGAAGGGACCATCGAAACGATTGCC, WBGene00037794
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term