WormMine: Gene WBGene00037807

• WormBase Gene ID: WBGene00037807
• Gene Name: Cbr-sly-1
• Sequence Name: CBG18370
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in vesicle-mediated transport. Is an ortholog of C. elegans sly-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18370.1	CBG18370.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18370	CBG18370		[unknown]

0 RNAi Result

21 Allele

• WBVar00009559
• WBVar00126260
• WBVar00126261
• WBVar00126264
• WBVar00126265
• WBVar00126262
• WBVar00126263
• WBVar00126268
• WBVar00126266
• WBVar00126267
• WBVar00126259
• WBVar00126250
• WBVar00126253
• WBVar00126254
• WBVar00126251
• WBVar00126252
• WBVar00126257
• WBVar00126258
• WBVar00126255
• WBVar00126256
• WBVar00126249

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056231
• Remark: CBG18370, TGTGGCTGAGGCAGTTCAAGGGGACCTGGATGCTTACAGAAGCAGTGAGGAAGAAATTAA, WBGene00037807
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term