WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038124 Gene Name  Cbr-ccar-1
Sequence Name  ? CBG18765 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans ccar-1. In C. elegans, ccar-1 is involved in hemidesmosome assembly. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18765b.1 CBG18765b.1   [unknown]
Transcript:CBG18765a.3 CBG18765a.3   [unknown]
Transcript:CBG18765a.2 CBG18765a.2   [unknown]
Transcript:CBG18765a.1 CBG18765a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18765a CBG18765a   [unknown]
CDS:CBG18765b CBG18765b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lst-3, TATCAATGGAGCCGCCGTGAATGTTGGGCAGAAGTTGAAGATGTTGAAGCAGGTGGAGAA, WBGene00038124   Expr1050756 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG18764, GCGACGAAGGATGCCGCACAAAACGCGACCTGTGCCATAAACACCATAAATGGGTCCCAT, WBGene00038123   Expr1056155 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG26265, GTATCGTCTGTTAATCCCACCAGCATCCCAACACCATCCCCATCGAAATCTCAGAATTTC, WBGene00087679   Expr1064269 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term