WormMine: Gene WBGene00038161

• WormBase Gene ID: WBGene00038161
• Gene Name: Cbr-kal-1
• Sequence Name: CBG18819
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable peptidase inhibitor activity. Predicted to be located in extracellular region. Is an ortholog of C. elegans kal-1. In C. elegans, kal-1 is involved in anatomical structure morphogenesis; embryo development; and neuron migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18819.1	CBG18819.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18819	CBG18819		[unknown]

0 RNAi Result

13 Allele

• WBVar00126953
• WBVar00126952
• WBVar00126951
• WBVar00126950
• WBVar00126944
• WBVar00126943
• WBVar00126942
• WBVar00126941
• WBVar00126948
• WBVar00126947
• WBVar00126946
• WBVar00126945
• WBVar00126949

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066313
• Remark: Cbr-kal-1, CAACAAAGGTCTGGGCCGTACCGTAAGCACTCAATTCGTGACTCATTCGGATTTCGAAAC, WBGene00038161
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term