WormMine: Gene WBGene00038183

• WormBase Gene ID: WBGene00038183
• Gene Name: CBG18870
• Sequence Name: CBG18870
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans Y52B11A.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18870.1	CBG18870.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18870	CBG18870		[unknown]

0 RNAi Result

21 Allele

• WBVar00051059
• WBVar00051054
• WBVar00051049
• WBVar00051064
• WBVar00127031
• WBVar00127030
• WBVar00127035
• WBVar00127034
• WBVar00127033
• WBVar00127032
• WBVar00127037
• WBVar00127036
• WBVar00127029
• WBVar00020059
• WBVar00020064
• WBVar00020069
• WBVar00020074
• WBVar00020079
• WBVar00020049
• WBVar00020084
• WBVar00020054

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053479
• Remark: CBG18870, AAGGAGAAGACGTTCAACGCATTCTACGCGACACTTCTTCAGCGATTCTGTGAATTTAAT, WBGene00038183
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term