WormMine: Gene WBGene00038207

• WormBase Gene ID: WBGene00038207
• Gene Name: Cbr-mrck-1
• Sequence Name: CBG18897
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Is an ortholog of C. elegans mrck-1. In C. elegans, mrck-1 is involved in several processes, including embryonic body morphogenesis; positive regulation of endocytic recycling; and regulation of Golgi organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18897a.2	CBG18897a.2		[unknown]
Transcript:CBG18897a.1	CBG18897a.1		[unknown]
Transcript:CBG18897b.2	CBG18897b.2		[unknown]
Transcript:CBG18897b.1	CBG18897b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18897b	CBG18897b		[unknown]
CDS:CBG18897a	CBG18897a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050516
• Remark: Cbr-mrck-1, AGAATGAGGTGGACATTTTCAATGTGACGCTTGCCGAATGGGTTCAAACGATTAATTTGA, WBGene00038207
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term