WormMine: Gene WBGene00038272

• WormBase Gene ID: WBGene00038272
• Gene Name: Cbr-ppt-1
• Sequence Name: CBG18981
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable palmitoyl hydrolase activity. Is an ortholog of C. elegans ppt-1. In C. elegans, ppt-1 is involved in several processes, including egg-laying behavior; mitochondrion organization; and protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18981.1	CBG18981.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18981	CBG18981		[unknown]

0 RNAi Result

1 Allele

• WBVar00127112

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062035
• Remark: Cbr-ppt-1, GCTGTCGACGGAGACCATCTTCAGATTCCAAGAGATGTCCTTGTCAACGAAATTATTAAA, WBGene00038272
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term