WormMine: Gene WBGene00038371

• WormBase Gene ID: WBGene00038371
• Gene Name: CBG19099
• Sequence Name: CBG19099
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable catalytic activity. Is an ortholog of C. elegans F09G2.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19099a.1	CBG19099a.1		[unknown]
Transcript:CBG19099b.1	CBG19099b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19099b	CBG19099b		[unknown]
CDS:CBG19099a	CBG19099a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066031
• Remark: CBG19099, AAATGGCCTATTTCCTACCGTACTCCTTTCAACTTCACAACCATGGCACATATGAAATTG, WBGene00038371
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term