WormMine: Gene WBGene00038390

• WormBase Gene ID: WBGene00038390
• Gene Name: CBG19118
• Sequence Name: CBG19118
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable mannose-6-phosphate isomerase activity and zinc ion binding activity. Predicted to be involved in GDP-mannose biosynthetic process and carbohydrate metabolic process. Is an ortholog of C. elegans C05C8.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19118.1	CBG19118.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19118	CBG19118		[unknown]

0 RNAi Result

17 Allele

• WBVar00127228
• WBVar00127227
• WBVar00127222
• WBVar00127221
• WBVar00127220
• WBVar00127226
• WBVar00127225
• WBVar00127224
• WBVar00127223
• WBVar00127219
• WBVar00127218
• WBVar00127217
• WBVar00127216
• WBVar00127215
• WBVar00127214
• WBVar00127213
• WBVar00127212

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062416
• Remark: CBG19118, TCTCGTTGTGGTCAGTGGAAAAGGAACGATCGAGGAGGCGACACAAGAAAATCAGCTGAT, WBGene00038390
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term