WormMine: Gene WBGene00038540

• WormBase Gene ID: WBGene00038540
• Gene Name: Cbr-eif-2Bdelta
• Sequence Name: CBG19294
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Initiation factor 2B-like, C-terminal; NagB/RpiA transferase-like; Initiation factor 2 subunit family; and Initiation factor 2B-related. Is an ortholog of C. elegans eif-2Bdelta. In C. elegans, eif-2Bdelta is involved in several processes, including determination of adult lifespan; lipid storage; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19294.1	CBG19294.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19294	CBG19294		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053177
• Remark: CBG19294, GATGCGAATTCAAGTGGAAGAGGTACAAGGCACGTGAAGAGCTTTGTCGATCGAGGATAT, WBGene00038540
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term