WormMine: Gene WBGene00038880

• WormBase Gene ID: WBGene00038880
• Gene Name: Cbr-smp-1
• Sequence Name: CBG19706
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable semaphorin receptor binding activity. Is an ortholog of C. elegans smp-1. In C. elegans, smp-1 is involved in nematode male tail mating organ morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19706a.1	CBG19706a.1		[unknown]
Transcript:CBG19706b.1	CBG19706b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19706a	CBG19706a		[unknown]
CDS:CBG19706b	CBG19706b		[unknown]

0 RNAi Result

29 Allele

• WBVar00000939
• WBVar00000949
• WBVar00000944
• WBVar00000979
• WBVar00000974
• WBVar00000989
• WBVar00000984
• WBVar00000959
• WBVar00000954
• WBVar00000969
• WBVar00000964
• WBVar00000994
• WBVar00127690
• WBVar00127689
• WBVar00127684
• WBVar00127683
• WBVar00127682
• WBVar00127688
• WBVar00127687
• WBVar00127686
• WBVar00127685
• WBVar00027467
• WBVar00027472
• WBVar00027477
• WBVar00027482
• WBVar00027487
• WBVar00027492
• WBVar00028134
• WBVar00028139

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069383
• Remark: Cbr-smp-1, CGGAATCAACACCCCATCTCGGGATAAGAACGCCATTGTCACCTCAATCAATCAGAATAC, WBGene00038880
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term