WormMine: Gene WBGene00039025

• WormBase Gene ID: WBGene00039025
• Gene Name: Cbr-skn-1
• Sequence Name: CBG19887
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Expressed in germ line. Is an ortholog of C. elegans skn-1. In C. elegans, skn-1 is involved in several processes, including endoderm development; positive regulation of macromolecule biosynthetic process; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19887.1	CBG19887.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19887	CBG19887		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr12352
• Pattern: Consistent with maternal function, Cb-skn-1 is expressed in the germline as assessed by in situ hybridization.

• Primary Identifier: Expr1064363
• Remark: Cbr-skn-1, TGCCGTCAACGTCGTACCGACAGACACGATAAGCAAACCAACATGAACCATTACATCTAG, WBGene00039025
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term