WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039025 Gene Name  Cbr-skn-1
Sequence Name  ? CBG19887 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Expressed in germ line. Is an ortholog of C. elegans skn-1. In C. elegans, skn-1 is involved in several processes, including endoderm development; positive regulation of macromolecule biosynthetic process; and response to stress. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG19887.1 CBG19887.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG19887 CBG19887   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr12352 Consistent with maternal function, Cb-skn-1 is expressed in the germline as assessed by in situ hybridization.  
Cbr-skn-1, TGCCGTCAACGTCGTACCGACAGACACGATAAGCAAACCAACATGAACCATTACATCTAG, WBGene00039025   Expr1064363 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term