WormMine: Gene WBGene00039327

• WormBase Gene ID: WBGene00039327
• Gene Name: Cbr-mec-12
• Sequence Name: CBG20310
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule-based process. Predicted to be located in microtubule. Is an ortholog of C. elegans mec-12. In C. elegans, mec-12 is involved in several processes, including positive regulation of multicellular organismal process; response to mechanical stimulus; and thigmotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20310.1	CBG20310.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20310	CBG20310		[unknown]

0 RNAi Result

23 Allele

• WBVar00053664
• WBVar00053639
• WBVar00053634
• WBVar00053629
• WBVar00053624
• WBVar00053654
• WBVar00053659
• WBVar00053644
• WBVar00053649
• WBVar00053619
• WBVar00053614
• WBVar00053604
• WBVar00053609
• WBVar00053599
• WBVar00053594
• WBVar00053589
• WBVar00128520
• WBVar00128524
• WBVar00128523
• WBVar00128522
• WBVar00128521
• WBVar00128526
• WBVar00128525

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052419
• Remark: Cbr-mec-12, CAAATTCGACCTTATGTACGCCAAGAGAGCATTTGTCCACTGGTATGTTGGAGAAGGAAT, WBGene00039327
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term