WormMine: Gene WBGene00039354

• WormBase Gene ID: WBGene00039354
• Gene Name: Cbr-top-1
• Sequence Name: CBG20349
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA topoisomerase type I (single strand cut, ATP-independent) activity. Predicted to be involved in DNA topological change. Predicted to be located in chromosome. Is an ortholog of C. elegans top-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20349b.1	CBG20349b.1		[unknown]
Transcript:CBG20349a.1	CBG20349a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20349b	CBG20349b		[unknown]
CDS:CBG20349a	CBG20349a		[unknown]

0 RNAi Result

5 Allele

• WBVar00028862
• WBVar00028847
• WBVar00028867
• WBVar00028852
• WBVar00028857

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068036
• Remark: Cbr-top-1, CGTGGCTGCCAAGATTCTATCCTATAATAGAGCCAACAGACAAGTCGCCATTCTGTGTAA, WBGene00039354
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term