WormMine: Gene WBGene00039670

• WormBase Gene ID: WBGene00039670
• Gene Name: Cbr-rpi-1
• Sequence Name: CBG20743
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in intracellular signal transduction. Is an ortholog of C. elegans rpi-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20743b.1	CBG20743b.1		[unknown]
Transcript:CBG20743a.1	CBG20743a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20743a	CBG20743a		[unknown]
CDS:CBG20743b	CBG20743b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061678
• Remark: CBG20743, GAATTCCCAGAGGAAGAGAAGAAAATCGATATGGCCATGATCCATCGTACTCCAACTCCT, WBGene00039670
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term