WormMine: Gene WBGene00039704

• WormBase Gene ID: WBGene00039704
• Gene Name: CBG20782
• Sequence Name: CBG20782
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calmodulin-lysine N-methyltransferase activity and protein heterodimerization activity. Predicted to be located in cytoplasm. Predicted to be part of FANCM-MHF complex. Is an ortholog of C. elegans Y48E1C.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20782b.1	CBG20782b.1		[unknown]
Transcript:CBG20782.1	CBG20782.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20782b	CBG20782b		[unknown]
CDS:CBG20782	CBG20782		[unknown]

0 RNAi Result

1 Allele

• WBVar00029767

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058311
• Remark: CBG20782, TCAATTCGATTCTCGATAAGAAGATTGGGAGAATTTGGAGTAGCGGTGAAGAGAAGGATG, WBGene00039704
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term