WormMine: Gene WBGene00039705

• WormBase Gene ID: WBGene00039705
• Gene Name: CBG20783
• Sequence Name: CBG20783
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable double-stranded RNA binding activity. Is an ortholog of C. elegans Y48C3A.18.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20783b.1	CBG20783b.1		[unknown]
Transcript:CBG20783a.1	CBG20783a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20783a	CBG20783a		[unknown]
CDS:CBG20783b	CBG20783b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055700
• Remark: CBG20783, TCGTATTGTTCGTTCTGGATGTGCTGAGAAGGAAACCATGAAAACGTTGAAATCATTTGG, WBGene00039705
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term