WormMine: Gene WBGene00039997

• WormBase Gene ID: WBGene00039997
• Gene Name: Cbr-wht-1
• Sequence Name: CBG21143
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans wht-1. In C. elegans, wht-1 is involved in regulatory ncRNA-mediated post-transcriptional gene silencing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21143.1	CBG21143.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21143	CBG21143		[unknown]

0 RNAi Result

10 Allele

• WBVar00039889
• WBVar00039864
• WBVar00039869
• WBVar00039874
• WBVar00039879
• WBVar00039884
• WBVar00129383
• WBVar00129384
• WBVar00129385
• WBVar00129386

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051099
• Remark: Cbr-wht-1, ATACGCCGTCGCAACAATTTTCGCCAACACAGATGTCGCCATGACCGTACTTCCAATTTT, WBGene00039997
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term