WormMine: Gene WBGene00039998

• WormBase Gene ID: WBGene00039998
• Gene Name: Cbr-mapk-15
• Sequence Name: CBG21144
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans mapk-15. In C. elegans, mapk-15 is involved in dopamine uptake; protein localization to ciliary transition zone; and regulation of cilium assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21144b.1	CBG21144b.1		[unknown]
Transcript:CBG21144a.1	CBG21144a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21144b	CBG21144b		[unknown]
CDS:CBG21144a	CBG21144a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052481
• Remark: CBG21144, TACTGATTACGATACGGCGAGAAGTCTACAAAAGTCGACGAGTATGGACAAGAACACGAG, WBGene00039998
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term