WormMine: Gene WBGene00040040

• WormBase Gene ID: WBGene00040040
• Gene Name: Cbr-cua-1
• Sequence Name: CBG21197
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP hydrolysis activity; ATPase-coupled monoatomic cation transmembrane transporter activity; and small molecule binding activity. Predicted to be involved in monoatomic cation transport. Predicted to be located in membrane. Is an ortholog of C. elegans cua-1. In C. elegans, cua-1 is involved in copper ion transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21197.1	CBG21197.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21197	CBG21197		[unknown]

0 RNAi Result

38 Allele

• WBVar00129535
• WBVar00129534
• WBVar00129537
• WBVar00129536
• WBVar00129539
• WBVar00129538
• WBVar00129541
• WBVar00129540
• WBVar00129543
• WBVar00129542
• WBVar00129545
• WBVar00129544
• WBVar00129547
• WBVar00129546
• WBVar00129549
• WBVar00129548
• WBVar00129513
• WBVar00129512
• WBVar00129515
• WBVar00129514
• WBVar00129517
• WBVar00129516
• WBVar00129519
• WBVar00129518
• WBVar00129521
• WBVar00129520
• WBVar00129523
• WBVar00129522
• WBVar00129525
• WBVar00129524

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058002
• Remark: Cbr-cua-1, AAGTGGCAATGGTTGGAGACGGAGTAAATGATTCGCCAGCTTTAGCTGAAGCAGATGTTG, WBGene00040040
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

9 GO Annotation

0 Homologues

0 Locations

9 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term