WormMine: Gene WBGene00040062

• WormBase Gene ID: WBGene00040062
• Gene Name: CBG21221
• Sequence Name: CBG21221
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glucosamine-6-phosphate deaminase activity. Predicted to be involved in N-acetylglucosamine metabolic process and carbohydrate metabolic process. Is an ortholog of C. elegans T03F6.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21221.1	CBG21221.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21221	CBG21221		[unknown]

0 RNAi Result

3 Allele

• WBVar00030507
• WBVar00030512
• WBVar00030517

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059833
• Remark: CBG21221, CCTTCATCAGGCAATCGAATGCGGTGTCTCTCATATGTGTACAGTATCCGCAATGCAAAT, WBGene00040062
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term