WormMine: Gene WBGene00040750

• WormBase Gene ID: WBGene00040750
• Gene Name: Cbr-hex-4
• Sequence Name: CBG22127
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable hexosaminidase activity. Predicted to be involved in carbohydrate metabolic process. Is an ortholog of C. elegans hex-4. In C. elegans, hex-4 is involved in polysaccharide metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22127.1	CBG22127.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22127	CBG22127		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064743
• Remark: Cbr-hex-4, ACCAATACTTGAATGATTTCCATTCCATTCATTCGAGAACAACCATCTATCCAGATCTCA, WBGene00040750
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term