WormMine: Gene WBGene00041206

• WormBase Gene ID: WBGene00041206
• Gene Name: CBG22702
• Sequence Name: CBG22702
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans F22F1.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22702a.1	CBG22702a.1		[unknown]
Transcript:CBG22702b.1	CBG22702b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22702b	CBG22702b		[unknown]
CDS:CBG22702a	CBG22702a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068261
• Remark: CBG22702, AAGAATGTGATGATCGGGACGAATATTATAATATGGTATCTCTACGTGCTTATCGTCTTC, WBGene00041206
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term