Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG22942.1 | CBG22942.1 | [unknown] |
Other
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L1_vs_embryo_downregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG22942, AAATCATCACCGTAATCGAGGATCTTAAGGTCTCCGTCGACGACCTCATCGAGAGAATCA, WBGene00041388 | Expr1051120 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |