WormMine: Gene WBGene00041435

• WormBase Gene ID: WBGene00041435
• Gene Name: Cbr-abce-1
• Sequence Name: CBG22999
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and ATP hydrolysis activity. Expressed widely. Is an ortholog of C. elegans abce-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22999b.1	CBG22999b.1		[unknown]
Transcript:CBG22999a.1	CBG22999a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22999a	CBG22999a		[unknown]
CDS:CBG22999b	CBG22999b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

3 Expression Patterns

• Primary Identifier: Expr4633
• Pattern: Expressed in: ubiquitous.

• Primary Identifier: Expr4634
• Remark: Species: C. briggsae.
• Pattern: In C. briggsae, the gene expressed in: ubiquitous.

• Primary Identifier: Expr1069928
• Remark: Cbr-abce-1, CCTATCGTCCGCGCATCAACAAATTCGAATCGGTGAAGGATGTAGAGCAGAAGAAGAGCG, WBGene00041435
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term