WormMine: Gene WBGene00041465

• WormBase Gene ID: WBGene00041465
• Gene Name: Cbr-klp-6
• Sequence Name: CBG23036
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; microtubule binding activity; and microtubule motor activity. Predicted to be involved in microtubule-based movement. Is an ortholog of C. elegans klp-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23036.1	CBG23036.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23036	CBG23036		[unknown]

0 RNAi Result

16 Allele

• WBVar00132680
• WBVar00132681
• WBVar00132684
• WBVar00132685
• WBVar00132682
• WBVar00132683
• WBVar00132688
• WBVar00132689
• WBVar00132686
• WBVar00132687
• WBVar00132692
• WBVar00132693
• WBVar00132690
• WBVar00132691
• WBVar00132694
• WBVar00132695

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062376
• Remark: Cbr-klp-6, TTCATCAACGGAAAACCGGTGCACGGCGAGACGCAACTCCAACAAAACGATCGTGTATTT, WBGene00041465
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term