WormMine: Gene WBGene00042007

• WormBase Gene ID: WBGene00042007
• Gene Name: Cbr-apb-3
• Sequence Name: CBG23734
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Predicted to be part of AP-3 adaptor complex. Is an ortholog of C. elegans apb-3. In C. elegans, apb-3 is involved in embryo development and lysosome organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23734.1	CBG23734.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23734	CBG23734		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070068
• Remark: Cbr-apb-3, AACATGTTATACAACTTGAAAATCCAGTCAACCCATCCTCGATTCCTCGATTTGTCAACG, WBGene00042007
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term