WormMine: Gene WBGene00042015

• WormBase Gene ID: WBGene00042015
• Gene Name: Cbr-let-630
• Sequence Name: CBG23745
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable rRNA binding activity and ribosomal small subunit binding activity. Predicted to be involved in mitochondrial translation. Predicted to be located in mitochondrion. Is an ortholog of C. elegans let-630.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23745.1	CBG23745.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23745	CBG23745		[unknown]

0 RNAi Result

3 Allele

• WBVar00015244
• WBVar00015249
• WBVar00015254

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1064491
• Remark: CBG23745, GCAGCAACATGTTTGCAGATCATGTCACTCACGGCGAATCGGACAAAACTAGAACCTCTC, WBGene00042015
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term