WormMine: Gene WBGene00042135

• WormBase Gene ID: WBGene00042135
• Gene Name: CBG23894
• Sequence Name: CBG23894
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable acyltransferase activity. Is an ortholog of C. elegans T20B3.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23894a.1	CBG23894a.1		[unknown]
Transcript:CBG23894b.1	CBG23894b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23894a	CBG23894a		[unknown]
CDS:CBG23894b	CBG23894b		[unknown]

0 RNAi Result

29 Allele

• WBVar00044219
• WBVar00044224
• WBVar00044229
• WBVar00133537
• WBVar00133540
• WBVar00133541
• WBVar00133538
• WBVar00133539
• WBVar00133544
• WBVar00133545
• WBVar00133542
• WBVar00133543
• WBVar00133548
• WBVar00133549
• WBVar00133546
• WBVar00133547
• WBVar00133552
• WBVar00133553
• WBVar00133550
• WBVar00133551
• WBVar00133556
• WBVar00133557
• WBVar00133554
• WBVar00133555
• WBVar00133560
• WBVar00133561
• WBVar00133558
• WBVar00133559
• WBVar00044214

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066053
• Remark: CBG23894, AAAGAGGATCTCAAGAAGTTATTCGACTCCGCCATGAATGCTCACAACCAATTGATGGCC, WBGene00042135
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term