WormMine: Gene WBGene00042479

• WormBase Gene ID: WBGene00042479
• Gene Name: Cbr-catp-7
• Sequence Name: CBG24344
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and P-type transmembrane transporter activity. Predicted to be located in membrane. Is an ortholog of C. elegans catp-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24344.1	CBG24344.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24344	CBG24344		[unknown]

0 RNAi Result

13 Allele

• WBVar00134025
• WBVar00134026
• WBVar00134027
• WBVar00134028
• WBVar00134029
• WBVar00134030
• WBVar00134031
• WBVar00025694
• WBVar00057029
• WBVar00057034
• WBVar00057039
• WBVar00057044
• WBVar00057049

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064859
• Remark: CBG24344, GCTCTTGTCACTTCTTACTCCGCATTCCTCTGTATGGCTGGCTACTCTCTAACCCAATTC, WBGene00042479
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term