WormMine: Gene WBGene00042488

• WormBase Gene ID: WBGene00042488
• Gene Name: Cbr-phy-3
• Sequence Name: CBG24361
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable L-ascorbic acid binding activity; iron ion binding activity; and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen. Is an ortholog of C. elegans phy-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24361.1	CBG24361.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24361	CBG24361		[unknown]

0 RNAi Result

2 Allele

• WBVar00134045
• WBVar00134046

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050327
• Remark: Cbr-phy-3, AAAAGTGATTGCCACCCTCTGGATTCGTGCCAAAGATCAGCCAGTGATCCCAATGGCTGC, WBGene00042488
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term