WormMine: Gene WBGene00042674

• WormBase Gene ID: WBGene00042674
• Gene Name: Cbr-tbx-9
• Sequence Name: CBG24603
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans tbx-9. In C. elegans, tbx-9 is involved in embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24603.1	CBG24603.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24603	CBG24603		[unknown]

0 RNAi Result

13 Allele

• WBVar00134409
• WBVar00134414
• WBVar00134415
• WBVar00134416
• WBVar00135469
• WBVar00040807
• WBVar00140340
• WBVar00140341
• WBVar00038097
• WBVar00140344
• WBVar00140345
• WBVar00140342
• WBVar00038102

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053021
• Remark: Cbr-tbx-9, CAACCATTGGTGACTGTCAAGATTCCATATACTGAGTTCATCGCTGTCACTGCTTATCAG, WBGene00042674
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term