WormMine: Gene WBGene00042750

• WormBase Gene ID: WBGene00042750
• Gene Name: Cbr-mask-1
• Sequence Name: CBG24701
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans mask-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24701a.1	CBG24701a.1		[unknown]
Transcript:CBG24701b.1	CBG24701b.1		[unknown]
Transcript:CBG24701c.1	CBG24701c.1		[unknown]
Transcript:CBG24701d.1	CBG24701d.1		[unknown]
Transcript:CBG24701e.1	CBG24701e.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24701c	CBG24701c		[unknown]
CDS:CBG24701b	CBG24701b		[unknown]
CDS:CBG24701e	CBG24701e		[unknown]
CDS:CBG24701d	CBG24701d		[unknown]
CDS:CBG24701a	CBG24701a		[unknown]

0 RNAi Result

3 Allele

• WBVar00044314
• WBVar00140382
• WBVar00140383

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066944
• Remark: CBG24701, GGTATTTCTCCACTGATGCTGGCTGCCATGAATGGACACAAAGAAACGACCAAAGTTCTA, WBGene00042750
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term