WormMine: Gene WBGene00050887

• WormBase Gene ID: WBGene00050887
• Gene Name: Cbr-daf-2
• Sequence Name: CBG15732
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine kinase activity. Is an ortholog of C. elegans daf-2. In C. elegans, daf-2 is involved in several processes, including regulation of developmental process; regulation of macromolecule metabolic process; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15732b.1	CBG15732b.1		[unknown]
Transcript:CBG15732a.1	CBG15732a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15732b	CBG15732b		[unknown]
CDS:CBG15732a	CBG15732a		[unknown]

0 RNAi Result

15 Allele

• WBVar00019067
• WBVar00019102
• WBVar00019072
• WBVar00019042
• WBVar00019107
• WBVar00019077
• WBVar00019047
• WBVar00019112
• WBVar00019082
• WBVar00019052
• WBVar00019087
• WBVar00019057
• WBVar00019092
• WBVar00019062
• WBVar00019097

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067384
• Remark: Cbr-daf-2, CTCATCGTGGAAACGGCCGTACGGCATTTGGCGAAACAGAACGTCTCATCGAGGAGCATC, WBGene00050887
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term