WormMine: Gene WBGene00051249

• WormBase Gene ID: WBGene00051249
• Gene Name: Cre-eef-1A.2
• Sequence Name: CRE00499
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable GTP binding activity; GTPase activity; and translation elongation factor activity. Predicted to be involved in translational elongation. Is an ortholog of C. elegans eef-1A.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00499.1	CRE00499.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00499	CRE00499		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE

1 Expression Patterns

• Primary Identifier: Expr1106754
• Remark: CRE00499, GATGGATCCACCGGAAAGGTCACCAAGTCCGCCCAGAAGGCTGCTCCAAAGAAGAAGTAA, WBGene00051249
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term