WormMine: Gene WBGene00051818

• WormBase Gene ID: WBGene00051818
• Gene Name: Cre-nhr-35
• Sequence Name: CRE00809
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable nuclear receptor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-35.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00809.1	CRE00809.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00809	CRE00809		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104259
• Remark: Cre-nhr-35, AAGTGGTGTCGCCAGAATAGACGTTTTGATGGAGGAACTAATACTAGCAGAGACTGATTA, WBGene00051818
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term