WormMine: Gene WBGene00051849

• WormBase Gene ID: WBGene00051849
• Gene Name: Cre-cst-1
• Sequence Name: CRE00825
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Is an ortholog of C. elegans cst-1. In C. elegans, cst-1 is involved in determination of adult lifespan and muscle cell development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00825.1	CRE00825.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00825	CRE00825		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096203
• Remark: Cre-cst-1, TTCATCCGATGCGTGCAATTTTCATGATCCCTACAAAGCCTCCGCCGACATTCAAAAAAC, WBGene00051849
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term