WormMine: Gene WBGene00052087

• WormBase Gene ID: WBGene00052087
• Gene Name: Cre-gap-1
• Sequence Name: CRE00466
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Rho GTPase activation protein; GTPase-activator protein for Ras-like GTPase; Ras GTPase-activating domain; Ras GTPase-activating protein; Pleckstrin homology domain; PH domain; and PH-like domain superfamily. Is an ortholog of C. elegans gap-1. In C. elegans, gap-1 is involved in chemosensory behavior; learning or memory; and negative regulation of Ras protein signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00466.1	CRE00466.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00466	CRE00466		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101864
• Remark: Cre-gap-1, GTTCCACTATCGACGTCACGGATGCCATTCAACTAGCACATGAAGAATACGAGAAAGAGA, WBGene00052087
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term