WormMine: Gene WBGene00052250

• WormBase Gene ID: WBGene00052250
• Gene Name: Cre-unc-70
• Sequence Name: CRE26958
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable actin binding activity and phospholipid binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be part of spectrin. Is an ortholog of C. elegans unc-70. In C. elegans, unc-70 is involved in several processes, including dendrite development; embryonic body morphogenesis; and muscle cell cellular homeostasis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26958.1	CRE26958.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26958	CRE26958		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1108313
• Remark: Cre-unc-70, ACCTCGAAGAAACCATCAAACTCATCAAGAAGCACGAGGCGTTCGAGAAATCGGCACTCG, WBGene00052250
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term