WormMine: Gene WBGene00052257

• WormBase Gene ID: WBGene00052257
• Gene Name: Cre-unc-68
• Sequence Name: CRE27285
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calcium ion binding activity and ryanodine-sensitive calcium-release channel activity. Predicted to be involved in calcium ion transmembrane transport and intracellular calcium ion homeostasis. Predicted to be located in membrane. Is an ortholog of C. elegans unc-68. In C. elegans, unc-68 is involved in locomotion; positive regulation of programmed cell death; and protein localization to organelle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27285.1	CRE27285.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27285	CRE27285		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092357
• Remark: Cre-unc-68, TTAACAAAGACGAAACGGAATACACCGGTCAGGAGACGTACGTTCGTGAGAAGTACGATA, WBGene00052257
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

10 GO Annotation

0 Homologues

0 Locations

10 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term