WormMine: Gene WBGene00052291

• WormBase Gene ID: WBGene00052291
• Gene Name: Cre-mys-1
• Sequence Name: CRE27303
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable histone acetyltransferase activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans mys-1. In C. elegans, mys-1 is involved in several processes, including negative regulation of DNA-templated transcription; negative regulation of cell fate specification; and protein localization to chromatin.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27303.1	CRE27303.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27303	CRE27303		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113984
• Remark: Cre-mys-1, ACACGTATAAATCCGCAGGCATTGCTGTGGAAACCAAAAGAGTATGGAAAGAAAAGGGTG, WBGene00052291
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term