WormMine: Gene WBGene00052500

• WormBase Gene ID: WBGene00052500
• Gene Name: CRE27093
• Sequence Name: CRE27093
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable proton transmembrane transporter activity. Predicted to be involved in proton motive force-driven ATP synthesis. Predicted to be part of mitochondrial proton-transporting ATP synthase complex, coupling factor F(o). Is an ortholog of C. elegans R04F11.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27093.1	CRE27093.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27093	CRE27093		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1115753
• Remark: CRE27093, GTCAACATTCCTTTCGAGGAGGGAGTCAAGCAATTCGGAGTTGCCGATCTCTACAAGGAC, WBGene00052500
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term